About   Help   FAQ
D5Mit267 Primer Detail
Primers
  • Name
    D5Mit267
  • Primer 1 Sequence
    AAGATGTTTCTGCCAGGATAGTG
  • Primer 2 Sequence
    TGGCATACCCAAGCAGATAA
  • ID
    MGI:704505
  • Product Size
    149
  • Note
    MIT assay: MT3684
Genes
D5Mit267 DNA segment, Chr 5, Massachusetts Institute of Technology 267
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit267 a 138bp 129X1/Sv
f 156bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit267 a 138bp LP/J
b 148bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 150bp SPRET/EiJ
d 154bp AKR/J, C3H/HeJ
e 156bp A/J, BALB/cJ, CAST/EiJ, DBA/2J, NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit267 c 203bp CBA/CaOlaHsd
s 202bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit267 a smaller 129P3/J
s larger SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory