About   Help   FAQ
D12Mit133 Primer Detail
Primers
  • Name
    D12Mit133
  • Primer 1 Sequence
    TGAGCAAAAGTTATTGGGTGG
  • Primer 2 Sequence
    GGAGATATTGCTTATGTCTCCCC
  • ID
    MGI:704498
  • Product Size
    113
  • Other IDs
    D12Mit133 (BROAD)
  • Note
    MIT assay: MT1154
    Additional information: MIT STS Marker Data Files
Genes
D12Mit133 DNA segment, Chr 12, Massachusetts Institute of Technology 133
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit133 a 95bp A/J
b 101bp AKR/J, NOD/MrkTac, NON/ShiLt
c 107bp DBA/2J
d 111bp C3H/HeJ
e 117bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D12Mit133 a 117bp BALB/cW, BN/aW, C57BL/6W, C57BL/10W
b 111bp 129/SvW, C3H/W, CBA/W
c 107bp DBA/2W
d 101bp AKR/W
e 95bp A.CA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory