D12Mit133 Primer Detail MGI Mouse MGI:704498

D12Mit133 Primer Detail

Name

D12Mit133
Primer 1 Sequence

TGAGCAAAAGTTATTGGGTGG
Primer 2 Sequence

GGAGATATTGCTTATGTCTCCCC
ID

MGI:704498
Product Size

113
Other IDs

D12Mit133 (BROAD)
Note

MIT assay: MT1154
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 133

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit133	a	95bp	A/J
	b	101bp	AKR/J, NOD/MrkTac, NON/ShiLt
	c	107bp	DBA/2J
	d	111bp	C3H/HeJ
	e	117bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D12Mit133	a	117bp	BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	b	111bp	129/SvW, C3H/W, CBA/W
	c	107bp	DBA/2W
	d	101bp	AKR/W
	e	95bp	A.CA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24