About   Help   FAQ
D12Mit136 Primer Detail
Primers
  • Name
    D12Mit136
  • Primer 1 Sequence
    TTTAATTTTGAGTGGGTTTGGC
  • Primer 2 Sequence
    TTGCTACATGTACACTGATCTCCA
  • ID
    MGI:704482
  • Product Size
    147
  • Other IDs
    D12Mit136 (BROAD)
  • Note
    MIT assay: MT1266
    Additional information: MIT STS Marker Data Files
Genes
D12Mit136 DNA segment, Chr 12, Massachusetts Institute of Technology 136
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit136 a 147bp B6.Cg-Lepob/+, C57BL/6J
b 165bp CAST/EiJ
c 175bp SPRET/EiJ
d 189bp DBA/2J
e 199bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
f 213bp A/J, BALB/cJ, C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit136 c 214bp CBA/CaOlaHsd
s 199bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D12Mit136 a 230bp A.CA/W, BALB/cW, C3H/W
b 210bp 129/SvW, BN/aW, CBA/W
c 189bp AKR/W, DBA/2W
d 147bp C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D12Mit136 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory