About   Help   FAQ
D1Mit362 Primer Detail
Primers
  • Name
    D1Mit362
  • Primer 1 Sequence
    TGTGTGACTGCTTGGAAGATG
  • Primer 2 Sequence
    CTGAGTCCCTAAAGTTGTCCTTG
  • ID
    MGI:704467
  • Product Size
    115
  • Other IDs
    D1Mit362 (BROAD)
  • Note
    MIT assay: MTAR4060
    Additional information: MIT STS Marker Data Files
Genes
D1Mit362 DNA segment, Chr 1, Massachusetts Institute of Technology 362
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit362 a 148bp 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
c 122, 148bp 129S/SvEv
d 116bp 129P1/ReJ, 129P2/Ola, 129P4/RrRkJ
e 146bp 129X1/SvJ
f 120bp C57BL/6J
g 140bp C3HeB/FeJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit362 a 148bp 129X1/Sv
b 116bp 129P2/Ola, CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit362 c 148bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit362 a 104bp LP/J
b 118bp BALB/cJ, NON/ShiLt
c 120bp B6.Cg-Lepob/+, C57BL/6J
d 122bp DBA/2J
e 124bp CAST/EiJ
f 148bp A/J, AKR/J, C3H/HeJ, NOD/MrkTac
g 184bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit362 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit362 c 148bp CBA/CaOlaHsd
s 113bp SWR/OlaHsd
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory