About   Help   FAQ
D1Mit136 Primer Detail
Primers
  • Name
    D1Mit136
  • Primer 1 Sequence
    TAGCCCTACACACTGTAGAAATGC
  • Primer 2 Sequence
    TGAACACAAAGTAGTAAATGCGTG
  • ID
    MGI:704456
  • Product Size
    103
  • Other IDs
    D1Mit136 (BROAD)
  • Note
    MIT assay: MPC1675
    Additional information: MIT STS Marker Data Files
Genes
D1Mit136 DNA segment, Chr 1, Massachusetts Institute of Technology 136
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit136 a 86bp CAST/EiJ
b 98bp SPRET/EiJ
c 102bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
d 104bp DBA/2J, LP/J, NOD/MrkTac
e 108bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit136 a 104bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, JF1
c 110bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 106bp 129P3/J, DBA/2J, SJL/J
p 84bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory