About   Help   FAQ
D8Mit339 Primer Detail
Primers
  • Name
    D8Mit339
  • Primer 1 Sequence
    ACCTATGGTACACACACATCGC
  • Primer 2 Sequence
    CAAACATTTTTAGGCATTTAGATCC
  • ID
    MGI:704442
  • Product Size
    123
  • Other IDs
    D8Mit339 (BROAD)
  • Note
    MIT assay: MTH2969
    Additional information: MIT STS Marker Data Files
Genes
D8Mit339 DNA segment, Chr 8, Massachusetts Institute of Technology 339
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit339 a 80bp SPRET/EiJ
b 84bp CAST/EiJ
c 106bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
d 108bp NOD/MrkTac, NON/ShiLt
e 122bp B6.Cg-Lepob/+, C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit339 c 102bp CBA/CaOlaHsd
s 101bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/21/2024
MGI 6.23 		The Jackson Laboratory