About   Help   FAQ
D1Mit215 Primer Detail
Primers
  • Name
    D1Mit215
  • Primer 1 Sequence
    GGAGCAGAGTGTGAGAAGGG
  • Primer 2 Sequence
    CCAGTGTGAGCCCATTCC
  • ID
    MGI:704420
  • Product Size
    149
  • Other IDs
    D1Mit215 (BROAD)
  • Note
    MIT assay: MT1279
    Additional information: MIT STS Marker Data Files
Genes
D1Mit215 DNA segment, Chr 1, Massachusetts Institute of Technology 215
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit215 a 135bp SPRET/EiJ
b 139bp AKR/J, LP/J
c 149bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
d 151bp NON/ShiLt
e 155bp CAST/EiJ
f 157bp A/J, BALB/cJ, C3H/HeJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit215 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory