About   Help   FAQ
DXMit46 Primer Detail
Primers
  • Name
    DXMit46
  • Primer 1 Sequence
    CTTTCCTGAGTGCCTCTTGG
  • Primer 2 Sequence
    TTCTGAATCTGTAATCTGTCTGGC
  • ID
    MGI:704407
  • Product Size
    253
  • Other IDs
    DXMit46 (BROAD)
  • Note
    MIT assay: MPC1759
    Additional information: MIT STS Marker Data Files
Genes
DXMit46 DNA segment, Chr X, Massachusetts Institute of Technology 46
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit46 a 246bp A/J, BALB/cJ, C3H/HeJ
b 248bp B6.Cg-Lepob/+
c 250bp AKR/J, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 256bp CAST/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit46 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory