About   Help   FAQ
D5Mit138 Primer Detail
Primers
  • Name
    D5Mit138
  • Primer 1 Sequence
    AGACAGTTACCTTCTTCCCAAGG
  • Primer 2 Sequence
    TGTTTCTCCCTTCTGCCATC
  • ID
    MGI:704389
  • Product Size
    147
  • Other IDs
    D5Mit138 (BROAD)
  • Note
    MIT assay: MT143
    Additional information: MIT STS Marker Data Files
Genes
D5Mit138 DNA segment, Chr 5, Massachusetts Institute of Technology 138
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit138 a 116bp AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
b 118bp SPRET/EiJ
c 140bp A/J, BALB/cJ, LP/J, NON/ShiLt
d 142bp CAST/EiJ
e 146bp B6.Cg-Lepob/+, C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit138 b 148bp C57BL/6JOlaHsd, C57BL/10
c 142bp 129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
d 120bp AKR/OlaHsd, C3H/HeJ, DBA/2J
j 136bp JF1
p 124bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit138 c 126bp CBA/CaOlaHsd
s 130bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory