About   Help   FAQ
D5Mit134 Primer Detail
Primers
  • Name
    D5Mit134
  • Primer 1 Sequence
    AAGCCAGAAGCCTGTTGTGT
  • Primer 2 Sequence
    GTCTGTTGTGAGTTCAGTAGGGG
  • ID
    MGI:704387
  • Product Size
    110
  • Other IDs
    D5Mit134 (BROAD)
  • Note
    MIT assay: MT633
    Additional information: MIT STS Marker Data Files
Genes
D5Mit134 DNA segment, Chr 5, Massachusetts Institute of Technology 134
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit134 a 85bp SPRET/EiJ
b 91bp C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
c 95bp CAST/EiJ
d 110bp C57BL/6J
e 111bp A/J, B6.Cg-Lepob/+, BALB/cJ, LP/J
f 113bp AKR/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit134 c 120bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory