About   Help   FAQ
D5Mit131 Primer Detail
Primers
  • Name
    D5Mit131
  • Primer 1 Sequence
    ATAATAATCATTAGTACTTGGGGTTCA
  • Primer 2 Sequence
    ACAAATAGCAAGACAAAAAACTTGG
  • ID
    MGI:704382
  • Product Size
    214
  • Other IDs
    D5Mit131 (BROAD)
  • Note
    MIT assay: MT134
    Additional information: MIT STS Marker Data Files
Genes
D5Mit131 DNA segment, Chr 5, Massachusetts Institute of Technology 131
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit131 a 210bp A/J, AKR/J, C3H/HeJ, DBA/2J
b 214bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
c 216bp BALB/cJ
d 218bp NOD/MrkTac, NON/ShiLt
e 240bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit131 c 138bp CBA/CaOlaHsd
s 143bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory