About   Help   FAQ
D10Mit267 Primer Detail
Primers
  • Name
    D10Mit267
  • Primer 1 Sequence
    ACACTTACAGTACCCTGGTGTGG
  • Primer 2 Sequence
    GTGTGTGGGCGGATGTAAG
  • ID
    MGI:704380
  • Product Size
    103
  • Other IDs
    D10Mit267 (BROAD)
  • Note
    MIT assay: MTH2006
    Additional information: MIT STS Marker Data Files
Genes
D10Mit267 DNA Segment, Chr 10, Massachusetts Institute of Technology 267
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit267 b smaller than f C57BL/6J
c 100bp C3HeB/FeJLe
f larger than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit267 a 94bp A/J, BALB/cJ, DBA/2J
b 100bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
c 104bp CAST/EiJ
d 116bp SPRET/EiJ
e 126bp LP/J, NOD/MrkTac, NON/ShiLt
f 136bp AKR/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit267 c lower CBA/Kw
k upper KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory