About   Help   FAQ
D10Mit266 Primer Detail
Primers
  • Name
    D10Mit266
  • Primer 1 Sequence
    ACCAACTACACAACATTGTCTTCTG
  • Primer 2 Sequence
    CAGTTGCAAAGATGCCACC
  • ID
    MGI:704379
  • Product Size
    94
  • Other IDs
    D10Mit266 (BROAD)
  • Note
    MIT assay: MTH533
    Additional information: MIT STS Marker Data Files
Genes
D10Mit266 DNA Segment, Chr 10, Massachusetts Institute of Technology 266
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit266 a 92bp A/J, BALB/cJ, NOD/MrkTac
b 100bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit266 c 87bp A/JOlaHsd, BALB/cJ
d 95bp AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
g 89bp 129P3/J, SJL/J
p 73bp JF1, PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit266 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory