About   Help   FAQ
D6Mit201 Primer Detail
Primers
  • Name
    D6Mit201
  • Primer 1 Sequence
    TGCTTCCTCTCTGCTGTAAGC
  • Primer 2 Sequence
    AACTAAGGCCAGTACTGAAAAGTACA
  • ID
    MGI:704366
  • Product Size
    145
  • Other IDs
    D6Mit201 (BROAD)
  • Note
    MIT assay: MT1374
    Additional information: MIT STS Marker Data Files
Genes
D6Mit201 DNA segment, Chr 6, Massachusetts Institute of Technology 201
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit201 a 123bp 129X1/Sv
f 118, 123bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit201 a 106bp C3H/HeJ, DBA/2J, SPRET/EiJ
b 116bp A/J, BALB/cJ, NOD/MrkTac
c 118bp CAST/EiJ, LP/J
d 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit201 a smaller 129P3/J
s larger SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory