D6Mit201 Primer Detail MGI Mouse MGI:704366

D6Mit201 Primer Detail

Name

D6Mit201
Primer 1 Sequence

TGCTTCCTCTCTGCTGTAAGC
Primer 2 Sequence

AACTAAGGCCAGTACTGAAAAGTACA
ID

MGI:704366
Product Size

145
Other IDs

D6Mit201 (BROAD)
Note

MIT assay: MT1374
Additional information: MIT STS Marker Data Files

D6Mit201

DNA segment, Chr 6, Massachusetts Institute of Technology 201

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit201	a	123bp	129X1/Sv
Not Specified	D6Mit201	f	118, 123bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit201	a	106bp	C3H/HeJ, DBA/2J, SPRET/EiJ
	b	116bp	A/J, BALB/cJ, NOD/MrkTac
	c	118bp	CAST/EiJ, LP/J
	d	148bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit201	a	smaller	129P3/J
	D6Mit201	s	larger	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24