About   Help   FAQ
D6Mit200 Primer Detail
Primers
  • Name
    D6Mit200
  • Primer 1 Sequence
    CATCAGGTGTCTTCAGGTTCTG
  • Primer 2 Sequence
    TCCCCTCTATCCTTACTGTTGC
  • ID
    MGI:704365
  • Product Size
    105
  • Other IDs
    D6Mit200 (BROAD)
  • Note
    MIT assay: MT2518
    Additional information: MIT STS Marker Data Files
Genes
D6Mit200 DNA segment, Chr 6, Massachusetts Institute of Technology 200
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit200 a 106bp 129X1/Sv
f 98, 102, 106bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit200 a 98bp NOD/MrkTac, NON/ShiLt
b 102bp AKR/J, C3H/HeJ, DBA/2J
c 104bp SPRET/EiJ
d 106bp LP/J
e 108bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
f 116bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory