About   Help   FAQ
D5Mit10 Primer Detail
Primers
  • Name
    D5Mit10
  • Primer 1 Sequence
    CGAGAAGTTGGAAAGACCCA
  • Primer 2 Sequence
    GGCACCCATGCCTCTATG
  • ID
    MGI:704353
  • Product Size
    195
  • Other IDs
    D5Mit10 (BROAD)
  • Note
    MIT assay: M207
    Additional information: MIT STS Marker Data Files
Genes
D5Mit10 DNA segment, Chr 5, Massachusetts Institute of Technology 10
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit10 a largest DBA/2
b smaller C57BL/6
c smallest JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit10 a 188bp A/J
b 190bp BALB/cJ
c 192bp NON/ShiLt
d 194bp C3H/HeJ
e 196bp B6.Cg-Lepob/+, C57BL/6J, LP/J
f 200bp NOD/MrkTac
g 201bp AKR/J
h 203bp DBA/2J
i 205bp SPRET/EiJ
j 209bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit10 a 204bp AKR/OlaHsd
b 198bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
c 190bp A/JOlaHsd, BALB/cJ
d 206bp DBA/2J
h 196bp C3H/HeJ, SJL/J
j 184bp JF1
p 194bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit10 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit10 c 156bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory