About   Help   FAQ
D5Mit11 Primer Detail
Primers
  • Name
    D5Mit11
  • Primer 1 Sequence
    GATCTTCCTACCTTCTTACCCAC
  • Primer 2 Sequence
    CATGATTTTATTTGGGGGG
  • ID
    MGI:704352
  • Product Size
    206
  • Other IDs
    D5Mit11 (BROAD)
  • Note
    MIT assay: M97
    Additional information: MIT STS Marker Data Files
Genes
D5Mit11 DNA segment, Chr 5, Massachusetts Institute of Technology 11
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit11 m 210bp MOLF/EiJ
s absent 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit11 a 188bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
b 195bp CAST/EiJ
c 199bp BALB/cJ
d 203bp B6.Cg-Lepob/+, LP/J
e 206bp C57BL/6J
f 210bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit11 c 133bp CBA/CaOlaHsd
s 136bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory