About   Help   FAQ
D12Mit101 Primer Detail
Primers
  • Name
    D12Mit101
  • Primer 1 Sequence
    GCTTTTCCTTATCAAGATATGCG
  • Primer 2 Sequence
    GCAGCAGAAAGAGAGGGAAA
  • ID
    MGI:704345
  • Product Size
    167
  • Other IDs
    D12Mit101 (BROAD)
  • Note
    MIT assay: MPC1706
    Additional information: MIT STS Marker Data Files
Genes
D12Mit101 DNA segment, Chr 12, Massachusetts Institute of Technology 101
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit101 c 118bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit101 a 112bp SPRET/EiJ
b 116bp AKR/J, BALB/cJ, NOD/MrkTac
c 118bp A/J, C3H/HeJ, DBA/2J
d 126bp CAST/EiJ
e 170bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory