About   Help   FAQ
D2Mit206 Primer Detail
Primers
  • Name
    D2Mit206
  • Primer 1 Sequence
    TGTCAGAACTGGACAATGTCG
  • Primer 2 Sequence
    ATGATAACAGACACTAATGATTAGGGC
  • ID
    MGI:704314
  • Product Size
    144
  • Other IDs
    D2Mit206 (BROAD)
  • Note
    MIT assay: MT1326
    Additional information: MIT STS Marker Data Files
Genes
D2Mit206 DNA segment, Chr 2, Massachusetts Institute of Technology 206
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit206 a 116bp LP/J, NOD/MrkTac, NON/ShiLt
b 141bp C3H/HeJ
c 145bp SPRET/EiJ
d 147bp B6.Cg-Lepob/+
e 149bp C57BL/6J, CAST/EiJ
f 151bp AKR/J, BALB/cJ
g 153bp DBA/2J
h 154bp A/J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit206 b 142bp C57BL/6JOlaHsd, C57BL/10
d 148bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, DBA/2J
g 116bp 129P3/J, SJL/J
j 134bp C3H/HeJ, JF1
p 144bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory