D2Mit206 Primer Detail MGI Mouse MGI:704314

D2Mit206 Primer Detail

Name

D2Mit206
Primer 1 Sequence

TGTCAGAACTGGACAATGTCG
Primer 2 Sequence

ATGATAACAGACACTAATGATTAGGGC
ID

MGI:704314
Product Size

144
Other IDs

D2Mit206 (BROAD)
Note

MIT assay: MT1326
Additional information: MIT STS Marker Data Files

D2Mit206

DNA segment, Chr 2, Massachusetts Institute of Technology 206

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit206	a	116bp	LP/J, NOD/MrkTac, NON/ShiLt
	b	141bp	C3H/HeJ
	c	145bp	SPRET/EiJ
	d	147bp	B6.Cg-Lep^ob/+
	e	149bp	C57BL/6J, CAST/EiJ
	f	151bp	AKR/J, BALB/cJ
	g	153bp	DBA/2J
	h	154bp	A/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit206	b	142bp	C57BL/6JOlaHsd, C57BL/10
	d	148bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, DBA/2J
	g	116bp	129P3/J, SJL/J
	j	134bp	C3H/HeJ, JF1
	p	144bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23