About   Help   FAQ
D16Mit146 Primer Detail
Primers
  • Name
    D16Mit146
  • Primer 1 Sequence
    ACCAATCTGGAGATATGTTACAAGG
  • Primer 2 Sequence
    TGGAAGACACATACTCTCTCTCTCA
  • ID
    MGI:704306
  • Product Size
    121
  • Other IDs
    D16Mit146 (BROAD)
  • Note
    MIT assay: MT3377
    Additional information: MIT STS Marker Data Files
Genes
D16Mit146 DNA segment, Chr 16, Massachusetts Institute of Technology 146
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit146 a 112bp NOD/MrkTac
b 116bp AKR/J, C57BL/6J, CAST/EiJ
c 123bp A/J, B6.Cg-Lepob/+, BALB/cJ, LP/J, NON/ShiLt, SPRET/EiJ
d 125bp C3H/HeJ, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D16Mit146 d 155bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB, SJL/J
g 165bp 129P3/J
h 153bp C3H/HeJ
j 147bp JF1
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit146 c 125bp CBA/CaOlaHsd
s 121bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory