D16Mit146 Primer Detail MGI Mouse MGI:704306

D16Mit146 Primer Detail

Name

D16Mit146
Primer 1 Sequence

ACCAATCTGGAGATATGTTACAAGG
Primer 2 Sequence

TGGAAGACACATACTCTCTCTCTCA
ID

MGI:704306
Product Size

121
Other IDs

D16Mit146 (BROAD)
Note

MIT assay: MT3377
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 146

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit146	a	112bp	NOD/MrkTac
	b	116bp	AKR/J, C57BL/6J, CAST/EiJ
	c	123bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, LP/J, NON/ShiLt, SPRET/EiJ
	d	125bp	C3H/HeJ, DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D16Mit146	d	155bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB, SJL/J
	g	165bp	129P3/J
	h	153bp	C3H/HeJ
	j	147bp	JF1

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit146	c	125bp	CBA/CaOlaHsd
	D16Mit146	s	121bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13