About   Help   FAQ
D4Mit71 Primer Detail
Primers
  • Name
    D4Mit71
  • Primer 1 Sequence
    TGAAAGAAACCCCAAACTGC
  • Primer 2 Sequence
    CACGAACATCCTCACACAATG
  • ID
    MGI:704231
  • Product Size
    117
  • Other IDs
    D4Mit71 (BROAD)
  • Note
    MIT assay: MPC1515
    Additional information: MIT STS Marker Data Files
Genes
D4Mit71 DNA segment, Chr 4, Massachusetts Institute of Technology 71
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit71 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit71 a 104bp SPRET/EiJ
b 112bp CAST/EiJ
c 114bp A/J, AKR/J, C3H/HeJ, LP/J
d 120bp B6.Cg-Lepob/+, C57BL/6J
e 122bp BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit71 a 120bp BALB/cW, BN/aW, C57BL/6W, DBA/2W
b 114bp 129/SvW, A.CA/W, AKR/W, C3H/W, CBA/W
c 110bp C57BL/10W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory