D17Mit7 Primer Detail MGI Mouse MGI:704223

D17Mit7 Primer Detail

Name

D17Mit7
Primer 1 Sequence

TCTAATCCCATGTATATGTGGTGG
Primer 2 Sequence

TTCCTCTGGACTCCTTGGG
ID

MGI:704223
Product Size

146
Note

MIT assay: A23

D17Mit7

DNA segment, Chr 17, Massachusetts Institute of Technology 7

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit7	a	145bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	146bp	NON/ShiLt
	c	152bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	d	154bp	AKR/J, NOD/MrkTac
	e	170bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit7	c	154bp	CBA/CaOlaHsd
	D17Mit7	s	149bp	SWR/OlaHsd

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit7	c	larger	CBA/Kw
	D17Mit7	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23