D16Mit6 Primer Detail MGI Mouse MGI:704218

D16Mit6 Primer Detail

Name

D16Mit6
Primer 1 Sequence

CAGGTCCAAGAGGAGAACCA
Primer 2 Sequence

TTTGACCTGTGAGCCTGTGG
ID

MGI:704218
Product Size

188
Note

MIT assay: L7

D16Mit6

DNA segment, Chr 16, Massachusetts Institute of Technology 6

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit6	m	197bp	MOLF/EiJ
Not Specified	D16Mit6	s	absent	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit6	a	171bp	CAST/EiJ
	b	181bp	LP/J
	c	185bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	191bp	AKR/J, DBA/2J
	e	209bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit6	a	210bp	AKR/W
	b	200bp	A.CA/W, BALB/cW, C3H/W, CBA/W, DBA/2W
	c	191bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit6	c	larger	CBA/Kw
	D16Mit6	e	smaller	KE

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23