About   Help   FAQ
D16Mit6 Primer Detail
Primers
  • Name
    D16Mit6
  • Primer 1 Sequence
    CAGGTCCAAGAGGAGAACCA
  • Primer 2 Sequence
    TTTGACCTGTGAGCCTGTGG
  • ID
    MGI:704218
  • Product Size
    188
  • Note
    MIT assay: L7
Genes
D16Mit6 DNA segment, Chr 16, Massachusetts Institute of Technology 6
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit6 m 197bp MOLF/EiJ
s absent 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit6 a 171bp CAST/EiJ
b 181bp LP/J
c 185bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 191bp AKR/J, DBA/2J
e 209bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D16Mit6 a 210bp AKR/W
b 200bp A.CA/W, BALB/cW, C3H/W, CBA/W, DBA/2W
c 191bp 129/SvW, BN/aW, C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D16Mit6 c larger CBA/Kw
e smaller KE
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory