About   Help   FAQ
D16Mit3 Primer Detail
Primers
  • Name
    D16Mit3
  • Primer 1 Sequence
    TCTAACGCCCTCTCTCTACC
  • Primer 2 Sequence
    CCAAATGTGATTGCACAAGG
  • ID
    MGI:704215
  • Product Size
    100
  • Other IDs
    D16Mit3 (BROAD)
  • Note
    MIT assay: M127
    Additional information: MIT STS Marker Data Files
Genes
D16Mit3 DNA segment, Chr 16, Massachusetts Institute of Technology 3
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit3 a largest MSM/Ms
b smaller JF1
c smallest C57BL/6, DBA/2
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit3 m 110bp MOLF/EiJ
s 118bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit3 a 76bp CAST/EiJ
b 97bp SPRET/EiJ
c 100bp C3H/HeJ, DBA/2J, LP/J
d 102bp B6.Cg-Lepob/+, C57BL/6J
e 104bp A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D16Mit3 l larger LG/J
s smaller SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory