D16Mit2 Primer Detail MGI Mouse MGI:704214

D16Mit2 Primer Detail

Name

D16Mit2
Primer 1 Sequence

CCAATGCCCTCTTATGACCT
Primer 2 Sequence

TTCTAGTGCGTCCTACCCAG
ID

MGI:704214
Product Size

189
Other IDs

D16Mit2 (BROAD)
Note

MIT assay: L80
Additional information: MIT STS Marker Data Files

D16Mit2

DNA segment, Chr 16, Massachusetts Institute of Technology 2

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit2	a	largest	JF1
		b	smaller	MSM/Ms
		c	smallest	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit2	a	173bp	SPRET/EiJ
	b	186bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	189bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit2	l	smaller	LG/J
	D16Mit2	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23