D2Mit372 Primer Detail MGI Mouse MGI:704181

D2Mit372 Primer Detail

Name

D2Mit372
Primer 1 Sequence

GAAGACTGAGTCACAACTTCTCTCC
Primer 2 Sequence

CGGAAGTGGAGAAAGTTACCC
ID

MGI:704181
Product Size

119
Other IDs

D2Mit372 (BROAD)
Note

MIT assay: MT4534
Additional information: MIT STS Marker Data Files

D2Mit372

DNA segment, Chr 2, Massachusetts Institute of Technology 372

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit372	a	103bp	SPRET/EiJ
	b	115bp	CAST/EiJ
	c	117bp	AKR/J
	d	119bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	e	123bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	127bp	BALB/cJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit372	b	117bp	C57BL/6JOlaHsd, C57BL/10
	c	121bp	BALB/cJ, JF1, PWB, SJL/J
	d	113bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, DBA/2J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13