About   Help   FAQ
D2Mit372 Primer Detail
Primers
  • Name
    D2Mit372
  • Primer 1 Sequence
    GAAGACTGAGTCACAACTTCTCTCC
  • Primer 2 Sequence
    CGGAAGTGGAGAAAGTTACCC
  • ID
    MGI:704181
  • Product Size
    119
  • Other IDs
    D2Mit372 (BROAD)
  • Note
    MIT assay: MT4534
    Additional information: MIT STS Marker Data Files
Genes
D2Mit372 DNA segment, Chr 2, Massachusetts Institute of Technology 372
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit372 a 103bp SPRET/EiJ
b 115bp CAST/EiJ
c 117bp AKR/J
d 119bp A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 123bp B6.Cg-Lepob/+, C57BL/6J
f 127bp BALB/cJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit372 b 117bp C57BL/6JOlaHsd, C57BL/10
c 121bp BALB/cJ, JF1, PWB, SJL/J
d 113bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, DBA/2J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory