About   Help   FAQ
D17Mit94 Primer Detail
Primers
  • Name
    D17Mit94
  • Primer 1 Sequence
    TGGAGAGGCATCCAACTCTC
  • Primer 2 Sequence
    TTCCTCTTAGTCCACCTTTTGC
  • ID
    MGI:704160
  • Product Size
    146
  • Other IDs
    D17Mit94 (BROAD)
  • Note
    MIT assay: MMH162
    Additional information: MIT STS Marker Data Files
Genes
D17Mit94 DNA segment, Chr 17, Massachusetts Institute of Technology 94
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit94 a 150bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 146bp 129X1/SvJ
c 144, 150bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit94 a 126bp CAST/EiJ
b 144bp A/J, AKR/J, C3H/HeJ, DBA/2J
c 150bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 154bp LP/J
e 160bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory