About   Help   FAQ
D17Mit93 Primer Detail
Primers
  • Name
    D17Mit93
  • Primer 1 Sequence
    TGTCCTTCGAGTGTTTGTGTG
  • Primer 2 Sequence
    TCCCCGGTGAATGAGTTATC
  • ID
    MGI:704157
  • Product Size
    153
  • Other IDs
    D17Mit93 (BROAD)
  • Note
    MIT assay: MPC1159
    Additional information: MIT STS Marker Data Files
Genes
D17Mit93 DNA segment, Chr 17, Massachusetts Institute of Technology 93
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit93 b 156bp C57BL/6J
c 154bp BALB/cJ
s 143bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit93 a 140bp LP/J, NOD/MrkTac, NON/ShiLt
b 148bp SPRET/EiJ
c 154bp BALB/cJ
d 155bp B6.Cg-Lepob/+
e 156bp C57BL/6J
f 160bp AKR/J
g 162bp A/J
h 168bp DBA/2J
i 170bp C3H/HeJ, CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit93 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit93 c 144bp CBA/CaOlaHsd
s 142bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit93 a smaller 129P3/J
s larger SJL/J
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory