D3Mit278 Primer Detail MGI Mouse MGI:704151

D3Mit278 Primer Detail

Name

D3Mit278
Primer 1 Sequence

AACTACCATCTAAAACATCCTCTGTG
Primer 2 Sequence

AGATCCCTAGAGAAACAGAACTGG
ID

MGI:704151
Product Size

112
Other IDs

D3Mit278 (BROAD)
Note

MIT assay: MTAR159
Additional information: MIT STS Marker Data Files

D3Mit278

DNA segment, Chr 3, Massachusetts Institute of Technology 278

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit278	a	92bp	BALB/cJ, LP/J
	b	106bp	CAST/EiJ
	c	108bp	A/J
	d	112bp	AKR/J, C3H/HeJ, DBA/2J
	e	116bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	f	120bp	NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D3Mit278	b	110bp	C57BL/6JOlaHsd, C57BL/10
	c	88bp	129P3/J, BALB/cJ
	d	106bp	AKR/OlaHsd, C3H/HeJ, DBA/2J, SJL/J
	j	94bp	JF1
	p	96bp	PWB
	w	102bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23