D3Mit273 Primer Detail MGI Mouse MGI:704141

D3Mit273 Primer Detail

Name

D3Mit273
Primer 1 Sequence

ACATGAAAAAGTGACAATGTTTAACA
Primer 2 Sequence

CTTTATTTGGACCTGTCTGTGTACC
ID

MGI:704141
Product Size

117
Other IDs

D3Mit273 (BROAD)
Note

MIT assay: MTH355
Additional information: MIT STS Marker Data Files

D3Mit273

DNA segment, Chr 3, Massachusetts Institute of Technology 273

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit273	a	117bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	b	120bp	AKR/J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	130bp	A/J, C3H/HeJ
	d	150bp	CAST/EiJ
	e	225bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit273	c	upper	CBA/Kw
	D3Mit273	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23