About   Help   FAQ
D11Mit163 Primer Detail
Primers
  • Name
    D11Mit163
  • Primer 1 Sequence
    AACCCTGCTATTGTGCTGCT
  • Primer 2 Sequence
    CTAGAACACACATGCATGCTCA
  • ID
    MGI:704133
  • Product Size
    134
  • Other IDs
    D11Mit163 (BROAD)
  • Note
    MIT assay: MT1391
    Additional information: MIT STS Marker Data Files
Genes
D11Mit163 DNA segment, Chr 11, Massachusetts Institute of Technology 163
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit163 a 137bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
b 141bp AKR/J, BALB/cJ, LP/J, NOD/MrkTac
c 145bp SPRET/EiJ
d 153bp CAST/EiJ
e 155bp A/J, C3H/HeJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D11Mit163 a 155bp A.CA/W, C3H/W, DBA/2W
b 141bp A.CA/W, BALB/cW
c 137bp AKR/W, C57BL/6W, C57BL/10W, CBA/W
d 126bp 129/SvW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory