About   Help   FAQ
D8Mit94 Primer Detail
Primers
  • Name
    D8Mit94
  • Primer 1 Sequence
    GTTGGGGCTCTGCTCTCTC
  • Primer 2 Sequence
    CACATATGCATACATATACATACACGT
  • ID
    MGI:704115
  • Product Size
    154
  • Other IDs
    D8Mit94 (BROAD)
  • Note
    MIT assay: MPC828
    Additional information: MIT STS Marker Data Files
Genes
D8Mit94 DNA segment, Chr 8, Massachusetts Institute of Technology 94
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit94 a 160bp 129X1/Sv
f 130bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit94 a 120bp CAST/EiJ
b 130bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
c 154bp B6.Cg-Lepob/+
d 156bp C57BL/6J
e 160bp LP/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory