D8Mit94 Primer Detail MGI Mouse MGI:704115

D8Mit94 Primer Detail

Name

D8Mit94
Primer 1 Sequence

GTTGGGGCTCTGCTCTCTC
Primer 2 Sequence

CACATATGCATACATATACATACACGT
ID

MGI:704115
Product Size

154
Other IDs

D8Mit94 (BROAD)
Note

MIT assay: MPC828
Additional information: MIT STS Marker Data Files

D8Mit94

DNA segment, Chr 8, Massachusetts Institute of Technology 94

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit94	a	160bp	129X1/Sv
Not Specified	D8Mit94	f	130bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit94	a	120bp	CAST/EiJ
	b	130bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	154bp	B6.Cg-Lep^ob/+
	d	156bp	C57BL/6J
	e	160bp	LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24