About   Help   FAQ
D12Mit12 Primer Detail
Primers
  • Name
    D12Mit12
  • Primer 1 Sequence
    TTCAATGCCTTCTGGCTTCT
  • Primer 2 Sequence
    GATTACCGGGTGTGTGACCT
  • ID
    MGI:704108
  • Product Size
    145
  • Other IDs
    D12Mit12 (BROAD)
  • Note
    MIT assay: B269
    Additional information: MIT STS Marker Data Files
Genes
D12Mit12 DNA segment, Chr 12, Massachusetts Institute of Technology 12
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit12 b smallest C57BL/6J
c 164bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit12 a 146bp B6.Cg-Lepob/+, C57BL/6J
b 152bp CAST/EiJ
c 156bp AKR/J, DBA/2J, LP/J, NON/ShiLt
d 164bp C3H/HeJ
e 166bp SPRET/EiJ
f 170bp A/J, BALB/cJ, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D12Mit12 b 144bp C57BL/6JOlaHsd
c 170bp A/JOlaHsd, BALB/cJ
d 154bp 129P3/J, AKR/OlaHsd, C57BL/10, DBA/2J, SJL/J
h 162bp C3H/HeJ
j 150bp JF1
p 160bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D12Mit12 l larger LG/J
s samller SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory