About   Help   FAQ
D13Mit202 Primer Detail
Primers
  • Name
    D13Mit202
  • Primer 1 Sequence
    TGACTCAAAAAGGTAGATAGATGGC
  • Primer 2 Sequence
    GATGCTATGTGTACATGCTTGTAGG
  • ID
    MGI:704105
  • Product Size
    141
  • Other IDs
    D13Mit202 (BROAD)
  • Note
    MIT assay: MT2365
    Additional information: MIT STS Marker Data Files
Genes
D13Mit202 DNA segment, Chr 13, Massachusetts Institute of Technology 202
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit202 a 139bp 129X1/Sv
f 121, 133, 139bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit202 a 121bp AKR/J
b 133bp A/J, NOD/MrkTac
c 137bp LP/J, NON/ShiLt
d 139bp C3H/HeJ, DBA/2J
e 141bp B6.Cg-Lepob/+, C57BL/6J
f 145bp BALB/cJ
g 147bp CAST/EiJ
h 166bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D13Mit202 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D13Mit202 a 114bp AKR/OlaHsd
b 136bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
c 140bp BALB/cJ, JF1
d 134bp C3H/HeJ, DBA/2J, SJL/J
p 142bp PWB
w 128bp A/JOlaHsd
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit202 c 138bp CBA/CaOlaHsd
s 148bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory