About   Help   FAQ
D15Mit193 Primer Detail
Primers
  • Name
    D15Mit193
  • Primer 1 Sequence
    TTGTGTAAGCCAATCTAATAAAGCC
  • Primer 2 Sequence
    GTTGCTGTGCTCATGGTGTC
  • ID
    MGI:704087
  • Product Size
    129
  • Other IDs
    D15Mit193 (BROAD)
  • Note
    MIT assay: MT3627
    Additional information: MIT STS Marker Data Files
Genes
D15Mit193 DNA segment, Chr 15, Massachusetts Institute of Technology 193
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit193 c 124bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit193 a 96bp CAST/EiJ
b 110bp DBA/2J, LP/J, NOD/MrkTac
c 114bp NON/ShiLt
d 116bp AKR/J
e 124bp C3H/HeJ
f 128bp BALB/cJ
g 130bp A/J, B6.Cg-Lepob/+, C57BL/6J
h 134bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D15Mit193 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory