About   Help   FAQ
D1Mit76 Primer Detail
Primers
  • Name
    D1Mit76
  • Primer 1 Sequence
    ACAAAGGAAACTAAACAGACTCGG
  • Primer 2 Sequence
    CTCCCTCAAATACATCTTTGGC
  • ID
    MGI:704085
  • Product Size
    205
  • Other IDs
    D1Mit76 (BROAD)
  • Note
    MIT assay: MPC825
    Additional information: MIT STS Marker Data Files
Genes
D1Mit76 DNA segment, Chr 1, Massachusetts Institute of Technology 76
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit76 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit76 a 204bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
b 210bp SPRET/EiJ
c 228bp CAST/EiJ
d 246bp AKR/J, NON/ShiLt
e 248bp A/J
f 250bp C3H/HeJ
g 252bp LP/J
h 254bp DBA/2J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory