D1Mit76 Primer Detail MGI Mouse MGI:704085

D1Mit76 Primer Detail

Name

D1Mit76
Primer 1 Sequence

ACAAAGGAAACTAAACAGACTCGG
Primer 2 Sequence

CTCCCTCAAATACATCTTTGGC
ID

MGI:704085
Product Size

205
Other IDs

D1Mit76 (BROAD)
Note

MIT assay: MPC825
Additional information: MIT STS Marker Data Files

D1Mit76

DNA segment, Chr 1, Massachusetts Institute of Technology 76

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit76	b	smaller	C57BL/6J
	D1Mit76	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit76	a	204bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	b	210bp	SPRET/EiJ
	c	228bp	CAST/EiJ
	d	246bp	AKR/J, NON/ShiLt
	e	248bp	A/J
	f	250bp	C3H/HeJ
	g	252bp	LP/J
	h	254bp	DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24