D13Mit57 Primer Detail MGI Mouse MGI:704083

D13Mit57 Primer Detail

Name

D13Mit57
Primer 1 Sequence

GATATACTTGTTTGCACACTTGGG
Primer 2 Sequence

AGAGAGTATGTGCCACCATGG
ID

MGI:704083
Product Size

140
Other IDs

D13Mit57 (BROAD)
Note

MIT assay: MPC1794
Additional information: MIT STS Marker Data Files

D13Mit57

DNA segment, Chr 13, Massachusetts Institute of Technology 57

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit57	a	152bp	129X1/Sv
Not Specified	D13Mit57	f	152, 156bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit57	a	130bp	SPRET/EiJ
	b	140bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	152bp	BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	d	156bp	A/J, CAST/EiJ, DBA/2J
	e	162bp	AKR/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13