About   Help   FAQ
D12Mit201 Primer Detail
Primers
  • Name
    D12Mit201
  • Primer 1 Sequence
    CCACTGGATGGCAACAGAC
  • Primer 2 Sequence
    TATGTGTTTCAAAACCACACTCG
  • ID
    MGI:704074
  • Product Size
    215
  • Other IDs
    D12Mit201 (BROAD)
  • Note
    MIT assay: MT3814
    Additional information: MIT STS Marker Data Files
Genes
D12Mit201 DNA segment, Chr 12, Massachusetts Institute of Technology 201
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit201 a 214bp 129X1/Sv
f 202bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit201 a 194bp SPRET/EiJ
b 196bp CAST/EiJ
c 202bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
d 206bp NOD/MrkTac
e 212bp AKR/J, B6.Cg-Lepob/+
f 214bp C57BL/6J, DBA/2J
g 220bp LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D12Mit201 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D12Mit201 c 202bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 216bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
g 226bp 129P3/J
j 232bp JF1
l 208bp SJL/J
p 236bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit201 c 201bp CBA/CaOlaHsd
s 198bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory