About   Help   FAQ
D12Mit221 Primer Detail
Primers
  • Name
    D12Mit221
  • Primer 1 Sequence
    CTCATCAGAAATCTCTGGATTCG
  • Primer 2 Sequence
    CCAAAGAAAAATAAGGTTACGTACG
  • ID
    MGI:704066
  • Product Size
    108
  • Other IDs
    D12Mit221 (BROAD)
  • Note
    MIT assay: MTH341
    Additional information: MIT STS Marker Data Files
Genes
D12Mit221 DNA segment, Chr 12, Massachusetts Institute of Technology 221
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit221 a 90bp A/J, BALB/cJ, C3H/HeJ
b 106bp AKR/J, LP/J, NOD/MrkTac
c 108bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 112bp DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D12Mit221 a 100bp 129P3/J, AKR/OlaHsd, SJL/J
b 102bp C57BL/6JOlaHsd, C57BL/10
c 82bp A/JOlaHsd, BALB/cJ, C3H/HeJ, JF1
d 106bp DBA/2J, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory