D1Mit171 Primer Detail MGI Mouse MGI:704039

D1Mit171 Primer Detail

Name

D1Mit171
Primer 1 Sequence

TGCAGATTCAGTCTGCCTTG
Primer 2 Sequence

AGCCATGGGAACACTCTCAC
ID

MGI:704039
Product Size

147
Other IDs

D1Mit171 (BROAD)
Note

MIT assay: MTH113
Additional information: MIT STS Marker Data Files

D1Mit171

DNA segment, Chr 1, Massachusetts Institute of Technology 171

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit171	a	150bp	129X1/Sv
Not Specified	D1Mit171	f	148, 150bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit171	a	148bp	B6.Cg-Lep^ob/+, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	b	150bp	AKR/J
	c	152bp	DBA/2J
	d	154bp	A/J, C3H/HeJ
	e	158bp	C57BL/6J
	f	184bp	CAST/EiJ
	g	200bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit171	c	150bp	CBA/CaOlaHsd
	D1Mit171	s	187bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24