About   Help   FAQ
D1Mit171 Primer Detail
Primers
  • Name
    D1Mit171
  • Primer 1 Sequence
    TGCAGATTCAGTCTGCCTTG
  • Primer 2 Sequence
    AGCCATGGGAACACTCTCAC
  • ID
    MGI:704039
  • Product Size
    147
  • Other IDs
    D1Mit171 (BROAD)
  • Note
    MIT assay: MTH113
    Additional information: MIT STS Marker Data Files
Genes
D1Mit171 DNA segment, Chr 1, Massachusetts Institute of Technology 171
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit171 a 150bp 129X1/Sv
f 148, 150bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit171 a 148bp B6.Cg-Lepob/+, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
b 150bp AKR/J
c 152bp DBA/2J
d 154bp A/J, C3H/HeJ
e 158bp C57BL/6J
f 184bp CAST/EiJ
g 200bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit171 c 150bp CBA/CaOlaHsd
s 187bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/26/2026
MGI 6.24
The Jackson Laboratory