About   Help   FAQ
DXMit135 Primer Detail
Primers
  • Name
    DXMit135
  • Primer 1 Sequence
    ACACTCCTACAAGCCTATAATCACG
  • Primer 2 Sequence
    TTTTCAAGTTATGTTTAAAAATGTGTG
  • ID
    MGI:704015
  • Product Size
    119
  • Other IDs
    DXMit135 (BROAD)
  • Note
    MIT assay: MTAR101
    Additional information: MIT STS Marker Data Files
Genes
DXMit135 DNA segment, Chr X, Massachusetts Institute of Technology 135
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit135 a 96bp SPRET/EiJ
b 116bp CAST/EiJ
c 118bp B6.Cg-Lepob/+, C57BL/6J
d 122bp A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 124bp AKR/J, BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit135 c 120bp CBA/CaOlaHsd
s 140bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory