About   Help   FAQ
DXMit73 Primer Detail
Primers
  • Name
    DXMit73
  • Primer 1 Sequence
    GTGCACATTTGTGTGTGTATGC
  • Primer 2 Sequence
    ACATGAAAGTTAGAAAGAGACCCG
  • ID
    MGI:704013
  • Product Size
    113
  • Note
    MIT assay: MT840
Genes
DXMit73 DNA segment, Chr X, Massachusetts Institute of Technology 73
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit73 a 115bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 121bp 129X1/SvJ
c 103bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit73 a 109bp SPRET/EiJ
b 113bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 123bp CAST/EiJ
d 125bp A/J, BALB/cJ, C3H/HeJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory