About   Help   FAQ
D18Mit94 Primer Detail
Primers
  • Name
    D18Mit94
  • Primer 1 Sequence
    TCACCTAGGACCCCCCTC
  • Primer 2 Sequence
    AAGTAGTGAGAGGCCACCACA
  • ID
    MGI:703991
  • Product Size
    148
  • Other IDs
    D18Mit94 (BROAD)
  • Note
    MIT assay: MT546
    Additional information: MIT STS Marker Data Files
Genes
D18Mit94 DNA segment, Chr 18, Massachusetts Institute of Technology 94
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit94 a 131bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
b 143bp A/J, BALB/cJ, DBA/2J
c 149bp B6.Cg-Lepob/+, C57BL/6J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D18Mit94 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory