About   Help   FAQ
D1Mit291 Primer Detail
Primers
  • Name
    D1Mit291
  • Primer 1 Sequence
    TGCCCGTGATAACCCTATGT
  • Primer 2 Sequence
    TTGTGCACAAGCAGGAGC
  • ID
    MGI:703967
  • Product Size
    145
  • Other IDs
    D1Mit291 (BROAD)
  • Note
    MIT assay: MT1775
    Additional information: MIT STS Marker Data Files
Genes
D1Mit291 DNA segment, Chr 1, Massachusetts Institute of Technology 291
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit291 a 125bp DBA/2J
b 133bp AKR/J
c 135bp A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
d 143bp CAST/EiJ
e 145bp B6.Cg-Lepob/+, C57BL/6J
f 153bp SPRET/EiJ
g 163bp NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit291 c 216bp CBA/CaOlaHsd
s 218bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory