D1Mit293 Primer Detail MGI Mouse MGI:703965

D1Mit293 Primer Detail

Name

D1Mit293
Primer 1 Sequence

AGACAGAGAGCAATAGATGAAGACC
Primer 2 Sequence

ACTGACCCGCTCTTCTCTACC
ID

MGI:703965
Product Size

149
Other IDs

D1Mit293 (BROAD)
Note

MIT assay: MT2613
Additional information: MIT STS Marker Data Files

D1Mit293

DNA segment, Chr 1, Massachusetts Institute of Technology 293

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit293	a	116bp	AKR/J, BALB/cJ
	b	128bp	SPRET/EiJ
	c	148bp	CAST/EiJ
	d	150bp	LP/J, NOD/MrkTac
	e	154bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	f	156bp	DBA/2J, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit293	c	151bp	CBA/CaOlaHsd
	D1Mit293	s	155bp	SWR/OlaHsd

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit293	c	upper	CBA/Kw
	D1Mit293	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23