About   Help   FAQ
D5Mit52 Primer Detail
Primers
  • Name
    D5Mit52
  • Primer 1 Sequence
    TTAGATACATGCTCACACATGCA
  • Primer 2 Sequence
    GTGGATACTTCAGGGGAAAGC
  • ID
    MGI:703956
  • Product Size
    144
  • Other IDs
    D5Mit52 (BROAD)
  • Note
    MIT assay: B215
    Additional information: MIT STS Marker Data Files
Genes
D5Mit52 DNA segment, Chr 5, Massachusetts Institute of Technology 52
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit52 b 0.144kb B10.BR-H2k, BALB.K-H2k, C57BL/6
c 0.132kb BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit52 a 132bp BALB/cJ
b 140bp LP/J
c 144bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
d 146bp NON/ShiLt
e 150bp CAST/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory