D5Mit297 Primer Detail MGI Mouse MGI:703953

D5Mit297 Primer Detail

Name

D5Mit297
Primer 1 Sequence

TCTGACCTCCACACATGCAC
Primer 2 Sequence

CTAAGGGACTCTTTGCTCATCC
ID

MGI:703953
Product Size

125
Other IDs

D5Mit297 (BROAD)
Note

MIT assay: MT4785
Additional information: MIT STS Marker Data Files

D5Mit297

DNA segment, Chr 5, Massachusetts Institute of Technology 297

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit297	a	118bp	SPRET/EiJ
	b	122bp	CAST/EiJ
	c	126bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac
	d	134bp	DBA/2J, NON/ShiLt
	e	144bp	BALB/cJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit297	c	upper	CBA/Kw
	D5Mit297	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24