D5Mit292 Primer Detail MGI Mouse MGI:703948

D5Mit292 Primer Detail

Name

D5Mit292
Primer 1 Sequence

GTCTTACTCCTGCCTGAACCC
Primer 2 Sequence

TTACCTTACACTGAGACCAGAAAGC
ID

MGI:703948
Product Size

111
Other IDs

D5Mit292 (BROAD)
Note

MIT assay: MT3622
Additional information: MIT STS Marker Data Files

D5Mit292

DNA segment, Chr 5, Massachusetts Institute of Technology 292

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit292	c	128bp	C3HeB/FeJLe
	D5Mit292	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit292	a	112bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	114bp	C57BL/6J
	c	118bp	CAST/EiJ
	d	128bp	C3H/HeJ
	e	136bp	AKR/J
	f	150bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit292	c	upper	CBA/Kw
	D5Mit292	e	lower	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24