About   Help   FAQ
D17Mit103 Primer Detail
Primers
  • Name
    D17Mit103
  • Primer 1 Sequence
    TACCACCTGGGCTACACCTC
  • Primer 2 Sequence
    GCAATGCTTAGGTTAAAGCAGG
  • ID
    MGI:703944
  • Product Size
    149
  • Other IDs
    D17Mit103 (BROAD)
  • Note
    MIT assay: D1207
    Additional information: MIT STS Marker Data Files
Genes
D17Mit103 DNA segment, Chr 17, Massachusetts Institute of Technology 103
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit103 a smallest M. spretus
b larger CAST/EiJ
c larger than above P/J
d larger than above C57BL/6J
e larger than above CBA/J, SJL/J
f larger than above A.CA-H2f/Sn
g larger than above RIIIS/J, SWR/J
h larger than above DBA/2J
i larger than above M. caroli
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit103 a 129bp SPRET/EiJ
b 131bp CAST/EiJ
c 137bp NON/ShiLt
d 147bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
e 149bp A/J, C3H/HeJ
f 159bp BALB/cJ, DBA/2J
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory