About   Help   FAQ
D17Mit102 Primer Detail
Primers
  • Name
    D17Mit102
  • Primer 1 Sequence
    CTGTGGGCAGGGCATAAG
  • Primer 2 Sequence
    AAACTGAATCAGTGACCCCG
  • ID
    MGI:703942
  • Product Size
    127
  • Other IDs
    D17Mit102 (BROAD)
  • Note
    MIT assay: D1201
    Additional information: MIT STS Marker Data Files
Genes
D2Mit1000 DNA segment, Chr 2, Massachusetts Institute of Technology 1000
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit1000 b larger C57BL/6J
f smaller FVB/N
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit1000 a smallest DBA/2J, P/J, RIIIS/J, SM/J, SWR/J
b larger A.CA-H2f/Sn, CBA/J
c larger than above CAST/EiJ, M. caroli
d larger than above SJL/J
e larger than above C57BL/6J
f larger than above M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit1000 a 123bp C3H/HeJ, DBA/2J, NON/ShiLt
b 127bp A/J, BALB/cJ
c 129bp CAST/EiJ, LP/J, NOD/MrkTac
d 133bp AKR/J
e 137bp B6.Cg-Lepob/+, C57BL/6J
f 147bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory