D17Mit102 Primer Detail MGI Mouse MGI:703942

D17Mit102 Primer Detail

Name

D17Mit102
Primer 1 Sequence

CTGTGGGCAGGGCATAAG
Primer 2 Sequence

AAACTGAATCAGTGACCCCG
ID

MGI:703942
Product Size

127
Other IDs

D17Mit102 (BROAD)
Note

MIT assay: D1201
Additional information: MIT STS Marker Data Files

DNA segment, Chr 2, Massachusetts Institute of Technology 1000

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit1000	b	larger	C57BL/6J
	D2Mit1000	f	smaller	FVB/N

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit1000	a	smallest	DBA/2J, P/J, RIIIS/J, SM/J, SWR/J
		b	larger	A.CA-H2^f/Sn, CBA/J
		c	larger than above	CAST/EiJ, M. caroli
		d	larger than above	SJL/J
		e	larger than above	C57BL/6J
		f	larger than above	M. spretus

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit1000	a	123bp	C3H/HeJ, DBA/2J, NON/ShiLt
	b	127bp	A/J, BALB/cJ
	c	129bp	CAST/EiJ, LP/J, NOD/MrkTac
	d	133bp	AKR/J
	e	137bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	147bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23